Guide RNA

The guide RNA are mainly transcribed from the intergenic region of DNA maxicircle and these are complementary to mature mRNA. It is important for gRNA to interact initially with pre-edited mRNA and then its 5' region base pair with complementary mRNA . The 3' end of gRNA contains oligo 'U' tail (5-25 nucleotides in length) which is a non encoded region but interacts and forms a stable complex with A and G rich region of mRNA. This initial hybrid helps in the recognition of specific mRNA site to be edited.[3]

The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein complexes that direct the cleavage of first mismatched base adjacent to gRNA-mRNA anchor. Uridyly transferase inserts 'U' at 3' terminal and RNA ligase is responsible for joining of two cut ends. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex. This process of modification is termed as original enzyme cascade model.[4]

In the case of "pan-edited" mRNAs,[5] the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A retroposition model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.

It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondrion of the ancestor of the kintoplastid protist lineage, since it is present in the bodonids which are ancestral to the trypanosomatids, and may not be present in the euglenoids, which branched from the same common ancestor as the kinetoplastids.

In the protozoan Leishmania tarentolae, 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is as follows:

mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'

The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) by basepairing (some G/U pairs are used). The 5' end does not exactly match and one of three specific endonucleases cleaves the mRNA at the mismatch site.

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5'   A  A   AGAAA   A G  G C UUUAACUUCAGGUUGU 3'

The mRNA is now "repaired" by adding U's at each editing site in succession, giving the following sequence:

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'

This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA)

Most of the prokaryotes like bacteria and archea makes the use of their adaptive immune system using CRISPR (clustered regularly interspaced short palindromic repeats) and cas enzyme to detect and remove the foreign genetic material. When prokaryotes are infected by bacteriophages, then the phage DNA give rise to short cluster repeats (CRISPR) which are used to detect and cleave the DNA fragments from similar type of phages. This defense mechanism of prokaryotes is used as editing technique which can used in gene therapy process as well. The CRISPR Cas editing method makes the use gRNA for identification and cleavage of DNA strands.

Guide RNA targets the complementary sequences by simple Watson-Crick base pairing. In type II CRISPR/cas system, single guide RNA directs the target specific regions. Single guide RNA are artificially programmed combination of two RNA molecules, one component (tracrRNA) is responsible for Cas9 endonuclease activity and other (crRNA) binds to the target specific DNA region. Therefore, the trans activating RNA (tracrRNA) and crRNA are two key components and are joined by tetraloop which results in formation of sgRNA. TracrRNA are base pairs having a stemloop structure in itself and attaches to the endonuclease enzyme. Transcription of CRISPR locus gives CRISPR RNA (crRNA) which have spacer flanked region due to repeat sequences, consisting of 18-20 base pair. crRNA identifies the specific complementary target region which is cleaved by Cas9 after its binding with crRNA and tcRNA, which all together known as effector complex. With the modifications in the crRNA sequences of the guide RNA, the binding location can be changed and hence defining it as a user defined program.

The targeting specificity of CRISPR-Cas9 is determined by the 20-nt sequence at the 5' end of the gRNA. The desired target sequence must precede the protospacer adjacent motif (PAM) which is a short DNA sequence usually 2-6 base pairs in length that follows the DNA region targeted for cleavage by the CRISPR system, such as CRISPR-Cas9. The PAM is required for a Cas nuclease to cut and is generally found 3-4 nucleotides downstream from the cut site. After base pairing of the gRNA to the target, Cas9 mediates a double strand break about 3-nt upstream of PAM.

The GC content of the guide sequence should be 40-80%. High GC content stabilizes the RNA-DNA duplex while destabilizing off-target hybridization. The length of the guide sequence should be between 17-24bp noting a shorter sequence minimizes off-target effects. Guide sequences less than 17bp have a chance of targeting multiple loci.

CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas9 is a technique used for gene editing and gene therapy. Cas is an endonuclease enzyme that cuts the DNA at a specific location directed by a guide RNA. This is a target-specific technique that can introduce gene knock out or knock in depending on the double strand repair pathway. Evidence shows that both in-vitro and in-vivo required tracrRNA for Cas9 and target DNA sequence binding. Three main stages constitute CRISPR CAS9 system. The first stage is extension of bases in the CRISPR locus region by addition of foreign DNA spacers in the genome sequence. Several different proteins, like cas1 and cas2, help in finding new spacers. The next stage involves transcription of CRISPR: pre-crRNA (precursor CRISPR RNA) are expressed by the transcription of CRISPR repeat-spacer array. On further modification in the pre-crRNA are converted to single spacer flanked region forming short crRNA. RNA maturation process is similar in type I and II but different in type III, aRNA as tracer are added in this step. The third stage involves binding of cas9 protein and directing it to cleave the DNA segment. Cas9 protein binds to combined form of crRNA and tracrRNA forming an effector complex. This act as guide RNA for cas9 protein directing it for its endonuclease activity.[6]

One important gene regulation method is RNA mutagenesis which can be introduced by RNA editing with the help of gRNA. Guide RNA replaces adenosine with inosine at the specific target site and modify the genetic code.[7] Adenosine deaminase acts on RNA bringing post transcriptional modification by altering the codons and different protein functions. Guide RNAs are the small nucleolar RNA, these along with riboproteins perform intracellular RNA alterations such as ribomethylation in rRNA and introduction of pseudouridine in preribosomal RNA. Guide RNAs binds to the anti sense RNA sequence and regulates the RNA modification. It is observed that small interfering RNA (siRNA) and micro RNA (miRNA) are generally used as target RNA sequence and modifications are comparatively easy to introduce because of small size.