Pachysolen tannophilus nuclear code
The pachysolen tannophilus nuclear code (translation table 26) is a genetic code found in the ascomycete fungus Pachysolen tannophilus.[1]
Code
AAs = FFLLSSSSYY**CC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -------------------M---------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (26) | Standard code (1) | |
|---|---|---|---|---|
| CTG | CUG | Ala (A) | Leu (L) |
Initiation codons
This code uses the initiation codons AUG, GUG and UUG.
Systematic range and comments
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin (2016). "A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes". Genome Research. 26 (7): 945–955. doi:10.1101/gr.200931.115. ISSN 1088-9051. PMC 4937558. PMID 27197221.
- Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 11 August 2016.