Trematode mitochondrial code
The trematode mitochondrial code (translation table 21) is a genetic code found in the mitochondria of Trematoda.
Code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (21) | Standard code (1) | |
|---|---|---|---|---|
| TGA | UGA | Trp (W) | STOP = Ter (*) | |
| ATA | AUA | Met (M) | Ile (I) | |
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| AAA | AAA | Asn (N) | Lys (K) |
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- Evolution of the mitochondrial genetic code. IV. AAA as an asparagine codon in some animal mitochondria. Ohama, T, S. Osawa, K. Watanabe, T.H. Jukes, 1990. J. Molec Evol. 30
- Platyhelminth mitochondrial DNA: evidence for early evolutionary origin of a tRNA(serAGN) that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons Garey, J.R. and D.R. Wolstenholme, 1989. J. Molec. Evol. 28: 374-387 329-332.
- Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 11 August 2016.
External links
This article is issued from Wikipedia. The text is licensed under Creative Commons - Attribution - Sharealike. Additional terms may apply for the media files.